pUC/M13 Sequencing Primers
Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
- Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
- Supplied at a concentration of 10μg/ml
- pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
- pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available
Catalog Number:
Choose a primer length and direction
Size
Catalog Number: Q5401
Catalog Number: Q5601
The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.
Primer Sequences
- Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
- Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´
Reference
- Messing, J. (1983) Meth. Enzymol. 101, 20–78.
Protocols
No protocols available
Specifications
Catalog Number:
What's in the box
| Item | Part # | Choose a size |
|---|---|---|
|
pUC/M13 Primer, Reverse (17mer) |
Q540A | 1 × 2μg |
SDS
Search for SDSCertificate of Analysis
Use Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.Storage Conditions
What's in the box
| Item | Part # | Choose a size |
|---|---|---|
|
pUC/M13 Primer, Forward (24mer) |
Q560A | 1 × 2μg |
SDS
Search for SDSCertificate of Analysis
Use Restrictions
For Research Use Only. Not for Use in Diagnostic Procedures.Storage Conditions
Resources
No related resources available
Related Products
Frequently Used With
pGEM®-T Vector Systems
T-vector for simplified cloning of PCR products.
A3600, A3610
pGEM®-T Easy Vector Systems
PCR cloning vectors with 3 options for insert excision.
A1360, A1380
pGEM-3Zf(+/–) Vectors
Vettori di clonazione standard che possono produrre ssDNA e trascrivere in vitro RNA senso e antisenso; offre uno screening blu/bianco.
P2271, P2261
pGEM®-3Z Vector
Da utilizzare come vettore di clonazione standard o per la sintesi efficiente ad alta fedeltà di RNA in vitro.
P2151
pGEM®-4Z Vector
Utilizzabile come vettore di clonazione standard e per la sintesi altamente efficiente di RNA in vitro.
P2161
pGEM-5Zf(+) Vector
Un vettore di clonazione standard usato come modello per la trascrizione in vitro o per la produzione di ssDNA circolare.
P2241
pGEM-7Zf(+) Vector
Vettore di clonazione standard usato come modello per la trascrizione in vitro o la produzione di ssDNA circolare.
P2251
