Upcoming System Maintenance

Notice: Promega will be performing essential system updates January 21–25.

Order processing and shipping will pause starting January 21 at 4:00 PM CST and resume on January 26.
Please plan to order in advance for any products needed during this timeframe.

Please contact Customer Service with any questions.

Q5401_pUC-3aM13-Primer--Reverse--17mer---2ug_3 new-kit-box

Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids

  • Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
  • Supplied at a concentration of 10μg/ml
  • pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
  • pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

Catalog Number:

Choose a primer length and direction

Size

Catalog Number: Q5401

Add Q5401 to Helix

Catalog Number: Q5601

Add Q5601 to Helix

Overview
Protocols
Specifications
Resources
Related Products

The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.

Primer Sequences

  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Reference

  1. Messing, J. (1983) Meth. Enzymol. 101, 20–78.

Protocols

No protocols available

Specifications

Catalog Number:

What's in the box

Item Part # Choose a size

pUC/M13 Primer, Reverse (17mer)

Q540A 1 × 2μg

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

What's in the box

Item Part # Choose a size

pUC/M13 Primer, Forward (24mer)

Q560A 1 × 2μg

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Resources

No related resources available