Upcoming System Maintenance

Notice: Promega will be performing essential system updates January 21–25.

Order processing and shipping will pause starting January 21 at 4:00 PM CST and resume on January 26.
Please plan to order in advance for any products needed during this timeframe.

Please contact Customer Service with any questions.

CloneWeaver® Workflow Purchasing Tool

Powering Your Cloning Workflow

Product selection has never been easier

Molecular Cloning is the process of producing recombinant DNA and transforming into host organisms to replicate and make more copies. Every cloning project is unique. Read More

Once you have designed the cloning scheme, gathering all of the required reagents to get you from construct to expression and analysis is not trivial. CloneWeaver helps you build a customized cloning "kit" with all of the items your cloning scheme requires. Purchase your selection instantly, save it or email it to a purchasing agent. Soon you'll have everything you require to create the construct you need.

Previous Next

Vectors: Subcloning Change

Name Description Part Number
pSP73 Vector Open/Close Add
Versatile vector that can be used for standard cloning and in vitro transcription
SP6 and T7 RNA polymerase promoters flank the multiple cloning region
Multiple cloning site provides a convenient selection of restriction sites for cloning

The pSP73 Vector can be used as a standard cloning vector and also can be used for transcription of RNA in vitro The pSP73 Vector contains the SP6 and T7 RNA polymerase promoters and a unique multiple cloning region, which includes restriction sites for BglII, EcoRV, ClaI, EcoRI, SacI, KpnI, SmaI, BamHI, XbaI, SalI, AccI, PstI, SphI, HindIII, PvuII and XhoI. The pSP72 and pSP73 Vectors are essentially identical except for the orientation of the multiple cloning site region.

Visit Product Page »
pUC/M13 Sequencing Primers Open/Close Add
Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
Supplied at a concentration of 10μg/ml
pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.

Visit Product Page »
Your Cloning Selections
QTY
None Selected
None Selected
None Selected
None Selected
None Selected
None Selected
None Selected

Save

Your selections can be accessed anytime at the link you will receive via email:


Share

To share your selections via email, complete the short form below: